Loading... Please wait...
Accurately characterize genetic variations from novel mutations to rare polymorphisms and more.
AccuMelt™ HRM SuperMix provides discrete differences in melt temperature and curve shape to allow discrimination of DNA sequence differences amongst different samples. AccuMelt is suitable for a broad range of applications including SNP analysis, mutation scanning, species identification and DNA methylation analysis.
Features and Benefits
Description
AccuMelt™ HRM SuperMix is a ready-to-use 2X concentrated hot-start PCR mix containing SYTO® 9 fluorescent DNA-binding dye. AccuStart™ DNA Polymerase allows for room-temperature reaction assembly and storage at +4°C for 6 months.
Superior Resolution of Genotypes
SNP Genotyping is a useful application for HRM and illustrates the capabilities of AccuMelt HRM SuperMix. Genotypes are readily identified based on unique melting profiles depending on a sample’s sequence (Figure 1). Furthermore, AccuMelt HRM SuperMix gives superior resolution of difficult genotypes when compared to the leading competitor’s mix based on greater Tm differences observed for A -> T transversions (Figure 2).

Fig. 1 High resolution melting analysis of a model SNP system with a single A,C,G,or T variant base. AccuMelt HRM SuperMix readily resolves each genotype and Tm differences are easily visualized in normalized melting curve plots (Roche LightCycler™ 480).

Fig. 2 Effect of T,A,C, or G variant base on Tm in a model HRM SNP system with either AccuMelt HRM SuperMix (Panel A), or a competitor’s SYTO® 9 dye master mix (Panel B). Plots of averaged melt peaks normalized to maximum signal for each system.
Comparison to TaqMan genotyping
TaqMan Genotyping has been used successfully in SNP analysis and other allelic discrimination applications. This widely adopted standard in genotyping was used as a benchmark to assess the utility of HRM with our SuperMix. AccuMelt HRM was determined to be just as effective as TaqMan Genotyping in SNP analysis and was even able to call the genotype for a difficult sample which the TaqMan assay could not resolve (Figure 3).

Fig.3 Accuracy of HRM genotyping with AccuMelt HRM SuperMix was evaluated by comparison to TaqMan detection of the G>A rs1801133 SNP in the MTHFR gene. All reactions were carried out using 10 ng of gDNA template from a random sample panel (ECACC HRC2 Human Random Control Panel, Sigma-Aldrich). TaqMan genotyping reactions were performed in 10µl volumes with PerfeCta qPCR SuperMix, Low ROX and 0.5X C___1202883_20 TaqMan® SNP Genotyping Assay (Applied Biosystems) on an AB 7500. Reactions were incubated for 5 min at 95°C, and then amplified for 45 cycles of 95°C, 5s; 60°C, 32s. Allelic discrimination calls were made using SDS v1.4 software. HRM reactions were carried out in 200µl reactions with 10 ng gDNA template and 300 nM of each primer (forward: CAAAGAAAAGCTGCGTGATGA; reverse: GGCTGACCTGAAGCACTTGAA). Reactions were incubated for 5 min at 95°C, and then amplified for 40 cycles of 95°C, 5s; 60°C, 15s, 70°C, 10s on a Roche LC480. Gene Scanning allele calls were made using “Auto Group” standards with a sensitivity setting of 0.5 and default normalization parameters.
HRM allelic discrimination of rs1801133 in ECACC HRC2 gDNA samples. Panel A) normalized melting curves; Panel B) TaqMan allelic discrimination plots. Sample D3 is labeled as “UNKN.”
Robust Amplification
Consistent robust amplification is critical to accuracy in HRM analysis. AccuMelt HRM SuperMix will drive all PCR amplifications to plateau regardless of the quantity of template input (Figure 4). This ensures accurate results regardless of the quantity of DNA available.

Fig. 4 High yield, high efficiency PCR with AccuMelt HRM SuperMix. Real-time PCR of GAPDH was amplified from log-fold serial dilutions of qScript™ synthesized cDNA from HeLa cell total RNA (10 ng to 0.1 pg) was carried out with either the leading SYBR Green master mix or AccuMelt HRM SuperMix using standard fast cycling conditions (95°C, 20s followed by 45 cycles of: 95°C, 3s; 60°C, 20s). Averaged plots for quadruplicate reactions for each input quantity are shown.
Presentation on HRM from the 2010 TATAA qPCR meeting in Gothenburg