Loading... Please wait...

Our Newsletter


AccuMelt™ HRM SuperMix

High resolution melting analysis of a model SNP system with a single A,C,G,or T variant base. AccuMelt HRM SuperMix readily resolves each genotype and Tm differences are easily visualized in normalized melting curve plots (Roche LightCycler™ 480).
  • High resolution melting analysis of a model SNP system with a single A,C,G,or T variant base. AccuMelt HRM SuperMix readily resolves each genotype and Tm differences are easily visualized in normalized melting curve plots (Roche LightCycler™ 480).
  • Effect of T,A,C, or G variant base on Tm in a model HRM SNP system with either AccuMelt HRM SuperMix (Panel A), or a competitor’s SYTO® 9 dye master mix (Panel B). Plots of averaged melt peaks normalized to maximum signal for each system.
  • Accuracy of HRM genotyping with AccuMelt HRM SuperMix was evaluated by comparison to TaqMan detection of the G>A rs1801133 SNP in the MTHFR gene. All reactions were carried out using 10 ng of gDNA template from a random sample panel (ECACC HRC2 Human Random Control Panel, Sigma-Aldrich). TaqMan genotyping reactions were performed in 10µl volumes with PerfeCta qPCR SuperMix, Low ROX and 0.5X C___1202883_20 TaqMan® SNP Genotyping Assay (Applied Biosystems) on an AB 7500. Reactions were incubated for 5 min at 95°C, and then amplified for 45 cycles of 95°C, 5s; 60°C, 32s. Allelic discrimination calls were made using SDS v1.4 software. HRM reactions were carried out in 200µl reactions with 10 ng gDNA template and 300 nM of each primer (forward: CAAAGAAAAGCTGCGTGATGA; reverse: GGCTGACCTGAAGCACTTGAA). Reactions were incubated for 5 min at 95°C, and then amplified for 40 cycles of 95°C, 5s; 60°C, 15s, 70°C, 10s on a Roche LC480. Gene Scanning allele calls were made using “Auto Group” standards with a sensitivity setting of 0.5 and default normalization parameters. HRM allelic discrimination of rs1801133 in ECACC HRC2 gDNA samples. Panel A) normalized melting curves; Panel B) TaqMan allelic discrimination plots. Sample D3 is labeled as “UNKN.”
  • High yield, high efficiency PCR with AccuMelt HRM SuperMix. Real-time PCR of GAPDH was amplified from log-fold serial dilutions of qScript™ synthesized cDNA from HeLa cell total RNA (10 ng to 0.1 pg) was carried out with either the leading SYBR Green master mix or AccuMelt HRM SuperMix using standard fast cycling conditions (95°C, 20s followed by 45 cycles of: 95°C, 3s; 60°C, 20s). Averaged plots for quadruplicate reactions for each input quantity are shown.
Price:
$244.00
SKU:
95103
Brand:
Quanta Biosciences
Shipping:
Calculated at checkout
Reactions:
Quantity:
Bookmark and Share

Product Description

Manual MSDS Free Sample

Description



 


AccuMelt HRM SuperMix is a 2x concentrated, ready to use reaction cocktail for detection of genetic variations using high resolution melting (HRM) analysis. It includes all required components except for primers and DNA template. HRM is a closed tube, rapid and cost effective procedure for characterization of sequences differences immediately following PCR amplification. It is based on the melting (dissociation) behavior of a PCR product as it transitions from double stranded to single stranded DNA in the presence of a fluorescent dsDNA binding dye.

Visit our Focus on HRM Analysis for extensive information on the HRM method.

Contents

  • 2 x reaction buffer containing optimized concentrations of MgCl2
  • dNTPs (including dUTP)
  • AccuStart Taq DNA Polymerase
  • SYTO® 9 green-fluorescent dye
  • stabilizers
  • Free Mg2+ = 0.8mM at 1x final concentration.

Storage conditions

AccuMelt HRM SuperMix is stable for 1 year when stored in a constant temperature freezer at 20°C, protected from light. For convenience, it may be stored unfrozen at +2 to +8°C for up to 6 months. After thawing, mix thoroughly by gently vortexing tube contents. Centrifuge briefly to collect contents before using. While repeated freezing and thawing of the product is not recommended, AccuMelt HRM SuperMix demonstrated no loss of performance after 20 cycles of freezing and thawing.

Write your own product review

Product Reviews

This product hasn't received any reviews yet. Be the first to review this product!

You Recently Viewed...